Review

mmp9 inhibitor (MedChemExpress)

MedChemExpress is a verified supplier

MedChemExpress manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

MedChemExpress mmp9 inhibitor

<t>MMP9</t> regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Mmp9 Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mmp9+inhibitor/pmc13037832-72-0-14?v=MedChemExpress
Average 93 stars, based on 17 article reviews

mmp9 inhibitor - by Bioz Stars, 2026-07

93/100 stars

Images

1) Product Images from "MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts"

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

Journal: Brazilian Journal of Medical and Biological Research

doi: 10.1590/1414-431X2026e15172

MMP9 regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Figure Legend Snippet: MMP9 regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Techniques Used: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

MMP9 downregulated MMP2 gene transcription through SMAD2/3. A , pGL-Luc-mMMP2-1387/+23 (p1387) was co-transfected with 100 ng pcDNA3.1-SMAD3 or pcDNA3.1-SMAD3 or pCDNA3.1. Transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. B , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad2. C , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad3. The data are reported as means±SD from independent experiments in triplicate. D , SMAD3 bound to -1368/-1348 in MMP2 promoter region. E , SMAD3 did not bind to -1271/-1251 in MMP2 promoter region. 32 P-labeled double stranded MMP2 probes were incubated with 5 μg of SMAD3 overexpressed cell nuclear extracts. The sequences selected for MMP2 probes are as follows: -1368 to -1348: ( 5'-CAAAGTCTTGTCTGAAGAGGA-3' ), -1271 to -1251: ( 5'-AACCAGAATGTCTGATTTTTA-3' ). Competition analysis of the SMAD3-MMP2 complex formation with 100-fold excess of unlabeled competitors or SBE site 1 mut ( 5'-CAAAGTCTAATTCAAAGAGGA-3' ) or SBE site 2 mut ( 5'- AACCAGAAAATTCAATTTTTA -3' ). Data are reported as means±SD. *P<0.05; ANOVA.

Figure Legend Snippet: MMP9 downregulated MMP2 gene transcription through SMAD2/3. A , pGL-Luc-mMMP2-1387/+23 (p1387) was co-transfected with 100 ng pcDNA3.1-SMAD3 or pcDNA3.1-SMAD3 or pCDNA3.1. Transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. B , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad2. C , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad3. The data are reported as means±SD from independent experiments in triplicate. D , SMAD3 bound to -1368/-1348 in MMP2 promoter region. E , SMAD3 did not bind to -1271/-1251 in MMP2 promoter region. 32 P-labeled double stranded MMP2 probes were incubated with 5 μg of SMAD3 overexpressed cell nuclear extracts. The sequences selected for MMP2 probes are as follows: -1368 to -1348: ( 5'-CAAAGTCTTGTCTGAAGAGGA-3' ), -1271 to -1251: ( 5'-AACCAGAATGTCTGATTTTTA-3' ). Competition analysis of the SMAD3-MMP2 complex formation with 100-fold excess of unlabeled competitors or SBE site 1 mut ( 5'-CAAAGTCTAATTCAAAGAGGA-3' ) or SBE site 2 mut ( 5'- AACCAGAAAATTCAATTTTTA -3' ). Data are reported as means±SD. *P<0.05; ANOVA.

Techniques Used: Transfection, Luciferase, Control, Labeling, Incubation

MMP9 regulated RUNX2, OSX, ALP, COL I, and OCN expression in lipopolysaccharide (LPS)-induced MC3T3-E1 cells. After pretreatment with pcDNA3.1 or pcDNA3.1-mMMP9 for 48 h, MC3T3-E1 cells were stimulated or not with 20 μg/mL LPS and cultured for another 12 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, ( D ) SMAD3, ( E ) RUNX2, ( F ) OSX, ( G ) ALP, ( H ) COL I, and ( I ) OCN was measured by qRT-PCR. J , Protein expression of MMP2, TGF-β1, P-SMAD2, SMAD2, P-SMAD3, and SMAD3 was measured by western blot. K , Protein expression of RUNX2, OSX, ALP, COL I, and OCN was measured by western blot. Immunofluorescence analysis of ( L ) phospho-SMAD2 and ( M ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. N , Alkaline phosphatase (ALP) staining (a1-a3) and alizarin red S (ARS) staining (b1-b3). O , Quantification of ALP staining. P , Quantification of ARS staining. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Figure Legend Snippet: MMP9 regulated RUNX2, OSX, ALP, COL I, and OCN expression in lipopolysaccharide (LPS)-induced MC3T3-E1 cells. After pretreatment with pcDNA3.1 or pcDNA3.1-mMMP9 for 48 h, MC3T3-E1 cells were stimulated or not with 20 μg/mL LPS and cultured for another 12 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, ( D ) SMAD3, ( E ) RUNX2, ( F ) OSX, ( G ) ALP, ( H ) COL I, and ( I ) OCN was measured by qRT-PCR. J , Protein expression of MMP2, TGF-β1, P-SMAD2, SMAD2, P-SMAD3, and SMAD3 was measured by western blot. K , Protein expression of RUNX2, OSX, ALP, COL I, and OCN was measured by western blot. Immunofluorescence analysis of ( L ) phospho-SMAD2 and ( M ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. N , Alkaline phosphatase (ALP) staining (a1-a3) and alizarin red S (ARS) staining (b1-b3). O , Quantification of ALP staining. P , Quantification of ARS staining. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Techniques Used: Expressing, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence, Staining

MMP9-regulated MMP2 expression was inhibited by TGF-β1 or SMAD2/3 in MC3T3-E1 cells. MC3T3-E1 cells were pretreated in the presence or absence of TGF-β1 or SMAD2/3 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, and ( D ) SMAD3 was measured by qRT-PCR. E , Protein expression of MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( F ) phospho-SMAD2 and ( G ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. H , mRNA and ( I ) protein expression of MMP2 was measured by qRT-PCR and western blot. The data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Figure Legend Snippet: MMP9-regulated MMP2 expression was inhibited by TGF-β1 or SMAD2/3 in MC3T3-E1 cells. MC3T3-E1 cells were pretreated in the presence or absence of TGF-β1 or SMAD2/3 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, and ( D ) SMAD3 was measured by qRT-PCR. E , Protein expression of MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( F ) phospho-SMAD2 and ( G ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. H , mRNA and ( I ) protein expression of MMP2 was measured by qRT-PCR and western blot. The data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Techniques Used: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

Image Search Results

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 downregulated MMP2 gene transcription through SMAD2/3. A , pGL-Luc-mMMP2-1387/+23 (p1387) was co-transfected with 100 ng pcDNA3.1-SMAD3 or pcDNA3.1-SMAD3 or pCDNA3.1. Transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. B , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad2. C , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad3. The data are reported as means±SD from independent experiments in triplicate. D , SMAD3 bound to -1368/-1348 in MMP2 promoter region. E , SMAD3 did not bind to -1271/-1251 in MMP2 promoter region. 32 P-labeled double stranded MMP2 probes were incubated with 5 μg of SMAD3 overexpressed cell nuclear extracts. The sequences selected for MMP2 probes are as follows: -1368 to -1348: ( 5'-CAAAGTCTTGTCTGAAGAGGA-3' ), -1271 to -1251: ( 5'-AACCAGAATGTCTGATTTTTA-3' ). Competition analysis of the SMAD3-MMP2 complex formation with 100-fold excess of unlabeled competitors or SBE site 1 mut ( 5'-CAAAGTCTAATTCAAAGAGGA-3' ) or SBE site 2 mut ( 5'- AACCAGAAAATTCAATTTTTA -3' ). Data are reported as means±SD. *P<0.05; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Transfection, Luciferase, Control, Labeling, Incubation

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated RUNX2, OSX, ALP, COL I, and OCN expression in lipopolysaccharide (LPS)-induced MC3T3-E1 cells. After pretreatment with pcDNA3.1 or pcDNA3.1-mMMP9 for 48 h, MC3T3-E1 cells were stimulated or not with 20 μg/mL LPS and cultured for another 12 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, ( D ) SMAD3, ( E ) RUNX2, ( F ) OSX, ( G ) ALP, ( H ) COL I, and ( I ) OCN was measured by qRT-PCR. J , Protein expression of MMP2, TGF-β1, P-SMAD2, SMAD2, P-SMAD3, and SMAD3 was measured by western blot. K , Protein expression of RUNX2, OSX, ALP, COL I, and OCN was measured by western blot. Immunofluorescence analysis of ( L ) phospho-SMAD2 and ( M ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. N , Alkaline phosphatase (ALP) staining (a1-a3) and alizarin red S (ARS) staining (b1-b3). O , Quantification of ALP staining. P , Quantification of ARS staining. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence, Staining

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9-regulated MMP2 expression was inhibited by TGF-β1 or SMAD2/3 in MC3T3-E1 cells. MC3T3-E1 cells were pretreated in the presence or absence of TGF-β1 or SMAD2/3 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, and ( D ) SMAD3 was measured by qRT-PCR. E , Protein expression of MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( F ) phospho-SMAD2 and ( G ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. H , mRNA and ( I ) protein expression of MMP2 was measured by qRT-PCR and western blot. The data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: MMP9 inhibitor (MMP-9-IN-1) and transforming growth factor-β1 (TGF-β1) inhibitor (Disitertide TFA) were purchased from MCE (USA).

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

Behavioral performance at 7 days postoperatively. (A) Flowchart of the experiment. MWM, Morris water maze; NORT, novel object recognition task; SB-3CT, MMP9 inhibitor. Aged SD rats were subjected to MWM training for five consecutive days preoperatively. On the day of surgery, SB-3CT at a dose of 25mg/kg was injected intraperitoneally at 2h and 4h postoperatively according to the group. NORT training was performed at 6 and 13 days postoperatively. On the 7th and 14th days after the operation, 10 rats were selected for the MWM testing and the NORT testing respectively. After the behavioral tests, the hippocampus of the rats were taken for subsequent experiments. (B) Water maze path performance at 7 days postoperatively. (C) Water maze swimming speed at 7 days postoperatively (n=10). (D) Water maze escape latency at 7 days postoperatively (n=10). (E) Number of times crossing target platform area at 7 days postoperatively (n=10). (F) Percentage of time in the platform quadrant at 7 days postoperatively (n=10). (G) Novel object recognition experiment trajectory plot. (H) Novel object recognition experiment recognition index at 7 days postoperatively (n=10). Data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, and *** p < 0.001 (one-way ANOVA). ns, not significant; C group, sham operation group; O group, operation group; N group, sham operation+inhibitor group; I group, operation+inhibitor group.

Journal: Frontiers in Immunology

Article Title: The critical role of matrix metalloproteinase 9-mediated microglial polarization in perioperative neurocognitive disorders of aged rats

doi: 10.3389/fimmu.2025.1650254

Figure Lengend Snippet: Behavioral performance at 7 days postoperatively. (A) Flowchart of the experiment. MWM, Morris water maze; NORT, novel object recognition task; SB-3CT, MMP9 inhibitor. Aged SD rats were subjected to MWM training for five consecutive days preoperatively. On the day of surgery, SB-3CT at a dose of 25mg/kg was injected intraperitoneally at 2h and 4h postoperatively according to the group. NORT training was performed at 6 and 13 days postoperatively. On the 7th and 14th days after the operation, 10 rats were selected for the MWM testing and the NORT testing respectively. After the behavioral tests, the hippocampus of the rats were taken for subsequent experiments. (B) Water maze path performance at 7 days postoperatively. (C) Water maze swimming speed at 7 days postoperatively (n=10). (D) Water maze escape latency at 7 days postoperatively (n=10). (E) Number of times crossing target platform area at 7 days postoperatively (n=10). (F) Percentage of time in the platform quadrant at 7 days postoperatively (n=10). (G) Novel object recognition experiment trajectory plot. (H) Novel object recognition experiment recognition index at 7 days postoperatively (n=10). Data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, and *** p < 0.001 (one-way ANOVA). ns, not significant; C group, sham operation group; O group, operation group; N group, sham operation+inhibitor group; I group, operation+inhibitor group.

Article Snippet: Skin incision and periosteal dissection were performed in group N, followed by intraperitoneal injection of 25mg/kg MMP9 inhibitor (SB-3CT) (AmBeed, A332833) as a suspension in a vehicle solution 10%DMSO+90% (20% SBE-β-CD in Saline) at 2h and 4h after the operation, respectively ( , ).

Techniques: Injection

Inflammatory factor protein imprints in the hippocampus at 7 and 14 days postoperatively. (A-D) The quantification of inflammatory factor protein blotting images and expression levels of MMP9, anti-inflammatory factor (IL-10) and pro-inflammatory factor (IL-1β) in the hippocampus at 7 days postoperatively (n=6). (E-H) The quantification of inflammatory factor protein blotting images and expression levels of MMP9, anti-inflammatory factor (IL-10) and pro-inflammatory factor (IL-1β) in the hippocampus at 14 days postoperatively (n=6). Data are presented as the mean ± SD. * p < 0.05 and ** p < 0.01 (one-way ANOVA). ns, not significant; C group, sham operation group; O group, operation group; N group, sham operation+inhibitor group; I group, operation+inhibitor group.

Journal: Frontiers in Immunology

Article Title: The critical role of matrix metalloproteinase 9-mediated microglial polarization in perioperative neurocognitive disorders of aged rats

doi: 10.3389/fimmu.2025.1650254

Figure Lengend Snippet: Inflammatory factor protein imprints in the hippocampus at 7 and 14 days postoperatively. (A-D) The quantification of inflammatory factor protein blotting images and expression levels of MMP9, anti-inflammatory factor (IL-10) and pro-inflammatory factor (IL-1β) in the hippocampus at 7 days postoperatively (n=6). (E-H) The quantification of inflammatory factor protein blotting images and expression levels of MMP9, anti-inflammatory factor (IL-10) and pro-inflammatory factor (IL-1β) in the hippocampus at 14 days postoperatively (n=6). Data are presented as the mean ± SD. * p < 0.05 and ** p < 0.01 (one-way ANOVA). ns, not significant; C group, sham operation group; O group, operation group; N group, sham operation+inhibitor group; I group, operation+inhibitor group.

Techniques: Expressing

Fig. 6 NET-derived dsRNA triggers PANoptosis in renal IRI. (A) TECs were subjected to OGD/R in the presence or absence of NETs, degranulation sub strate, DNase I, an MMP9 inhibitor, an NE inhibitor, and an MPO inhibitor. Western blotting was performed to assess the expression of cleaved GSDMD (C- GSDMD), cleaved Caspase-3 (C-Caspase-3) and phosphorylated MLKL (P-MLKL) (n = 3 per group). (B) NET formation was induced by phorbol 12-myristate 13-acetate (PMA). DNase I, RNase T1, or RNase III was used to treat NETs. The expression of CitH3, dsRNA and DNA was observed by confocal microscopy (n = 6 per group). (C) Neutrophils were activated with PMA, ionomycin or IRI conditional medium (CM) for 4–8 h. The level of intracellular dsRNA was as sessed by flow cytometry (n = 4 per group). (D) TECs were treated with OGD/R in the presence or absence of NETs, poly(I: C), or RNase III. Western blotting was performed to assess the expression of C-GSDMD, C-Caspase-3 and P-MLKL (n = 3 per group)

Journal: Cell communication and signaling : CCS

Article Title: Neutrophil extracellular trap-derived double-stranded RNA aggravates PANoptosis in renal ischemia reperfusion injury.

doi: 10.1186/s12964-025-02145-8

Figure Lengend Snippet: Fig. 6 NET-derived dsRNA triggers PANoptosis in renal IRI. (A) TECs were subjected to OGD/R in the presence or absence of NETs, degranulation sub strate, DNase I, an MMP9 inhibitor, an NE inhibitor, and an MPO inhibitor. Western blotting was performed to assess the expression of cleaved GSDMD (C- GSDMD), cleaved Caspase-3 (C-Caspase-3) and phosphorylated MLKL (P-MLKL) (n = 3 per group). (B) NET formation was induced by phorbol 12-myristate 13-acetate (PMA). DNase I, RNase T1, or RNase III was used to treat NETs. The expression of CitH3, dsRNA and DNA was observed by confocal microscopy (n = 6 per group). (C) Neutrophils were activated with PMA, ionomycin or IRI conditional medium (CM) for 4–8 h. The level of intracellular dsRNA was as sessed by flow cytometry (n = 4 per group). (D) TECs were treated with OGD/R in the presence or absence of NETs, poly(I: C), or RNase III. Western blotting was performed to assess the expression of C-GSDMD, C-Caspase-3 and P-MLKL (n = 3 per group)

Article Snippet: TECs were treated in the presence or absence of NETs, degranulation substrate, DNase I (2 μg/mL, Sigma), an MMP9 inhibitor (Sivelestat, 10 μM, Selleck), an NE inhibitor (SB-3CT, 10 μM, Selleck), an MPO inhibitor (MPO-IN-28, 10 μM, Selleck), a TLR3 inhibitor (CU-CPT 4a, 10 μM, MCE), poly(I: C) (MCE, 20 μg/mL), or RNase III (40 U/mL, Thermo).

Techniques: Derivative Assay, Western Blot, Expressing, Confocal Microscopy, Flow Cytometry

Review

Structured Review

Images

1) Product Images from "MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts"

Similar Products

Image Search Results